After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CD44 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD44cDNA Clone Product Information
cDNA Size:2100
cDNA Description:ORF Clone of Homo sapiens CD44 molecule (Indian blood group) DNA.
Gene Synonym:IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp1, CDW44, CSPG8, HCELL, HUTCH-I, ECMR-III, CD44
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

CD44 is a type I transmembrane protein and a member of the cartilage link protein family. It is involved in cell-cell and cell-matrix interactions and signal transduction. Several CD44 ligands have been identified. The most extensively characterized ligand for CD44 is hyaluronan, a component of the extracellular matrix. CD44 protein is expressed on the majority of immune cells. The binding of CD44 to hyaluronan is induced on T lymphocytes after activation by antigen and on monocytes after stimulation by inflammatory agents. Under inflammatory conditions, CD44 on endothelial cells presents hyaluronan to CD44 on activated T lymphocytes and mediates a rolling interaction under flow conditions. Perturbations of the hyaluronan-CD44 interaction at the plasma membrane by various antagonists result in attenuation of receptor tyrosine kinase and transporter activities and inhibition of tumor progression in vivo. CD44 is known to interact with the ezrin family (ERM family) members and form a complex that plays diverse roles within both normal and abnormal cells, particularly cancer cells. CD44 and ezrin and their respective complex have properties suggesting that they may be important in the process of tumour-endothelium interactions, cell migrations, cell adhesion, tumour progression and metastasis.

  • Bajorath J. (2000) Molecular organization, structural features, and ligand binding characteristics of CD44, a highly variable cell surface glycoprotein with multiple functions. Proteins. 39(2): 103-11.
  • Johnson P, et al. (2000) A role for the cell adhesion molecule CD44 and sulfation in leukocyte-endothelial cell adhesion during an inflammatory response? Biochem Pharmacol. 59(5): 455-65.
  • Martin TA, et al. (2003) The role of the CD44/ezrin complex in cancer metastasis. Crit Rev Oncol Hematol. 46(2): 165-86.
  • Toole BP, et al. (2008) Hyaluronan, CD44 and Emmprin: partners in cancer cell chemoresistance. Drug Resist Updat. 11(3): 110-21.
  • Johnson P, et al. (2009) CD44 and its role in inflammation and inflammatory diseases. Inflamm Allergy Drug Targets. 8(3): 208-20.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items