After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CASQ1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CASQ1cDNA Clone Product Information
cDNA Size:1173
cDNA Description:ORF Clone of Homo sapiens calsequestrin 1 (fast-twitch, skeletal muscle) DNA.
Gene Synonym:CASQ, PDIB1, CASQ1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-FLAG
Vector Size 6143bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-FLAG (suitable for secretary and membane protein expession) Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Calsequestrin-1 is an isoform of calsequestrin. Calsequestrin is a calcium-binding protein of the sarcoplasmic reticulum. It helps hold calcium in the cisterna of the sarcoplasmic reticulum after a muscle contraction, even though the concentration of calcium in the sarcoplasmic reticulum is much higher than in the cytosol. Two forms of calsequestrin have been identified: Calsequestrin-2 and Calsequestrin-1. Calsequestrin-1 is found in fast skeletal muscle. The release of calsequestrin-bound calcium (through a calcium release channel) triggers muscle contraction. The active protein is not highly structured, more than 50% of it adopting a random coil conformation. When calcium binds there is a structural change whereby the alpha-helical content of the protein increases from 3 to 11%. Both forms of calsequestrin are phosphorylated by casein kinase 2, but the cardiac form is phosphorylated more rapidly and to a higher degree. Calsequestrin-1 is also secreted in the gut where it deprives bacteria of calcium ions.

  • Slupsky JR, et al. (1987) Characterization of cardiac calsequestrin. Biochemistry. 26(20): 6539-44.
  • Cala SE, et al. (1991) Phosphorylation of cardiac and skeletal muscle calsequestrin isoforms by casein kinase II. Demonstration of a cluster of unique rapidly phosphorylated sites in cardiac calsequestrin. J Biol Chem. 266(1):391-8.
  • Wang S, et al. (1998) Crystal structure of calsequestrin from rabbit skeletal muscle sarcoplasmic reticulum. Nat Struct Biol. 5(6):476-83.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items