After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human TIGIT / VSTM3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TIGITcDNA Clone Product Information
Gene_bank_ref_id:NM_173799.2
cDNA Size:735
cDNA Description:ORF Clone of Homo sapiens T cell immunoreceptor with Ig and ITIM domains DNA.
Gene Synonym:VSIG9, VSTM3, FLJ39873, DKFZp667A205
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-10 and diminished the production of IL-12p40. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"