Quick Order

Human DNASE1 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DNASE1 cDNA Clone Product Information
Gene_bank_ref_id:BC029437
RefSeq ORF Size:849bp
cDNA Description:Full length Clone DNA of Homo sapiens deoxyribonuclease I with N terminal Flag tag.
Gene Synonym:DKFZp686H0155, DNL1, DRNI, FLJ38093, FLJ44902, DNASE1
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

DNase1, also known as deoxyribonuclease I and DNL1, is a member of the DNase family. DNaseI is a nuclease that cleaves DNA preferentially at phosphodiester linkages adjacent to a pyrimidine nucleotide, yielding 5'-phosphate-terminated polynucleotides with a free hydroxyl group on position 3', on average producing tetranucleotides. DNaseI binds to the cytoskeletal protein actin. It binds actin monomers with very high (sub-nanomolar) affinity and actin polymers with lower affinity. Mutations in DNase1 gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. DNase1 is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity.

References
  • Shak S. et al., 1991, Proc Natl Acad Sci. 87 (23): 9188-92.
  • Yasutomo K. et al., 2001, Nat Genet. 28 (4): 313-4.
  • Hakkim A. et al., 2010, Proc Natl Acad Sci. 107 (21): 9813-8.
  • Size / Price
    Catalog: HG13801-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"