Quick Order

Human ENTPD3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ENTPD3 cDNA Clone Product Information
Gene_bank_ref_id:NM_001248.2
RefSeq ORF Size:1509bp
cDNA Description:Full length Clone DNA of Homo sapiens ectonucleoside triphosphate diphosphohydrolase 3 with C terminal His tag.
Gene Synonym:HB6, CD39L3, FLJ93839, NTPDase-3
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Fausther M, et al. (2010) Cystic fibrosis remodels the regulation of purinergic signaling by NTPDase1 (CD39) and NTPDase3. Am J Physiol Lung Cell Mol Physiol. 298(6): 804-18.
  • Vlajkovic SM, et al. (2006) Noise-induced up-regulation of NTPDase3 expression in the rat cochlea: Implications for auditory transmission and cochlear protection. Brain Res. 1104(1): 55-63.
  • Ivanenkov w, et al. (2005) Characterization of disulfide bonds in human nucleoside triphosphate diphosphohydrolase 3 (NTPDase3): implications for NTPDase structural modeling. Biochemistry. 44 (25): 8998-9012.
  • Size / Price
    Catalog: HG10909-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"