Quick Order

Text Size:AAA

Human PLAC9 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLAC9cDNA Clone Product Information
Gene_bank_ref_id:NM_001012973.1
cDNA Size:294
cDNA Description:ORF Clone of Homo sapiens placenta-specific 9 DNA.
Gene Synonym:PLAC9
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

PLAC9 belongs to the PLAC9 family. PLAC9 gene is a placental-enriched gene. There are other two placental-enriched genes: Plac1 and Plac8. Plac1 is strongly expressed in all trophoblast-derived cells in the placenta and has been described in 2000. Plac8 expression is restricted to the spongiotrophoblast layer during development, whereas PLAC9 is weakly expressed though highly enriched in placenta. For both, cDNAs with complete open reading frames were recovered and exon-intron structures inferred from comparisons of mouse cDNA and genomic sequence. The predicted proteins both contain putative signal peptides, with a coiled-coil segment of mPLAC9 as the only other detected motif. Genomic sequence comparisons reveal that in addition to an apparent pseudogene on chromosome 1, Plac8 is expressed at mouse cytoband 5e3.

References
  • Deloukas P. et al., 2004, Nature. 429 (6990): 375-81.
  • Galaviz-Hernandez C. et al., 2003, Gene. 309 (2): 81-9.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalog:HG13971-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"