Quick Order

Text Size:AAA

Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK5cDNA Clone Product Information
cDNA Size:879
cDNA Description:ORF Clone of Homo sapiens cyclin-dependent kinase 5 DNA.
Gene Synonym:PSSALRE
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10897-ACG$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10897-ACR$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10897-ANG$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10897-ANR$325
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10897-CF$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10897-CH$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10897-CM$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10897-CY$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone)HG10897-M$95
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10897-M-F$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10897-M-N$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10897-NF$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10897-NH$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10897-NM$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10897-NY$295
Human CDK5 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10897-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Cell division protein kinase 5, also known as Cyclin-dependent kinase 5, Serine/threonine-protein kinase PSSALRE, Tau protein kinase II catalytic subunit, TPKII catalytic subunit and CDK5, is a cytoplasm protein which belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family and CDC2 / CDKX subfamily. Cyclin-dependent kinases (Cdks) are a family of proline-directed Ser/Thr kinases known for their role in the control of cell cycle progression. In 1992, this family was joined by CDK5, which is an atypical member in that it uses its own activators and is multifunctional, playing important regulatory roles in multiple cellular functions. CDK5, unlike other Cdks, is not regulated by cyclins, and its activity is primarily detected in postmitotic neurons in developing and adult nervous systems. CDK5 is activated by association with a neuron-specific activator, p35 or its isoform p39. CDK5 is probably involved in the control of the cell cycle. It interacts with D1 and D3-type G1 cyclins. CDK5 can phosphorylate histone H1, tau, MAP2 and NF-H and NF-M. It also interacts with p35 which activates the kinase. CDK5 plays important roles in various neuronal activities, including neuronal migration, synaptic activity, and neuronal cell death.

  • Smith,D.S. et al., 2001, Cell Growth Differ. 12 (6):277-83.
  • Mapelli,M. et al., 2003, Neurosignals.  12 (4-5):164-72.
  • Cheng,K. et al., 2003, Neurosignals. 12 (4-5):180-90.
  • Fischer,A. et al., 2003, Curr Drug Targets CNS Neurol Disord 2 (6): 375 - 81.
  • Lalioti,V. et al., 2010, Cell Cycle  9 (2): 284-311.