Quick Order

Human SEZ6L2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SEZ6L2 cDNA Clone Product Information
Gene_bank_ref_id:BC000567
RefSeq ORF Size:2430bp
cDNA Description:Full length Clone DNA of Homo sapiens seizure related 6 homolog (mouse)-like 2 with C terminal Myc tag.
Gene Synonym:PSK-1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SEZ6L2, also known as PSK-1, belongs to the SEZ6 family. It contains 3 CUB domains and 5 Sushi (CCP/SCR) domains. SEZ6L2 may contribute to specialized endoplasmic reticulum functions in neurons.SEZ6L2 presents on the surface of lung-cancer cells. SEZ6L2 should be a useful prognostic marker of lung cancers. Increased expression of this gene has been found in lung cancers, and the protein is therefore considered to be a novel prognostic marker for lung cancer.

References
  • Bedoyan JK. et al., 2010, Am J Med Genet A. 152A (6): 1567-74.
  • Konyukh M. et al., 2011, PLoS One. 6 (3): e17289.
  • Wang J. et al., 2011, Mol Syst Biol. 7: 536.
  • Size / Price
    Catalog: HG13969-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"