After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human AFP ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AFP cDNA Clone Product Information
Gene_bank_ref_id:BC027881
RefSeq ORF Size:1830bp
cDNA Description:Full length Clone DNA of Homo sapiens alpha-fetoprotein with N terminal Myc tag.
Gene Synonym:FETA, HPAFP, AFP
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Alpha-fetoprotein (AFP) is classified as a member of the albuminoid gene superfamily consisting of albumin, AFP, vitamin D (Gc) protein, and alpha-albumin. AFP is a glycoprotein of 591 amino acids and a carbohydrate moiety. AFP is one of the several embryo-specific proteins and is a dominant serum protein as early in human embryonic life as one month, when albumin and transferrin are present in relatively small amounts. It is first synthesized in the human by the yolk sac and liver(1-2 months) and subsequently predominantly in the liver. A small amount of AFP is produced by the GI tract of the human conceptus. It has been proved that AFP may reappear in the serum in elevated amounts in adult life in association with normal restorative processes and with malignant growth. Alpha-fetoprotein (AFP) is a specific marker for hepatocellular carcinoma (HCC), teratoblastomas, and neural tube defect (NTD).

References
  • Mizejewski GJ. (2001) Alpha-fetoprotein Structure and Function: Relevance to Isoforms, Epitopes, and Conformational Variants. Exp Biol Med. 226(5): 377-408.
  • Tomasi TB, et al. (1977) Structure and Function of Alpha-Fetoprotein. Annual Review of Medicine. 28: 453-65.
  • Leguy MC, et al. (2011) Assessment of AFP in amniotic fluid: comparison of three automated techniques. Ann Biol Clin. 69(4): 441-6.
  • Size / Price
    Catalog: HG12177-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"