Quick Order

Text Size:AAA

Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
METAP1DcDNA Clone Product Information
cDNA Size:1008
cDNA Description:ORF Clone of Homo sapiens methionine aminopeptidase 1D DNA.
Gene Synonym:AT4G37040, METHIONINE
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10883-ACG$325
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10883-ACR$325
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10883-ANG$325
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10883-ANR$325
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10883-CF$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10883-CH$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10883-CM$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10883-CY$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone)HG10883-M$95
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10883-M-F$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10883-NF$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10883-NH$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10883-NM$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10883-NY$295
Human METAP1D / MAP1D Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10883-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Methionine aminopeptidase 1D, also known as MAP1D, is a member of the peptidase M24A family. N-terminal methionine removal is an important cellular process required for proper biological activity, subcellular localization, and eventual degradation of many proteins. The enzymes that catalyze this reaction are called Methionine aminopeptidases (MAPs). MAP1D is overexpressed in colon cancer cell lines and colon tumors as compared to normal tissues (at protein level). Downregulation of MAP1D expression by shRNA in HCT-116 colon carcinoma cells reduces anchorage-independant growth in soft agar. MAP1D binds two cobalt ions per subunit. The true nature of the physiological cofactor is under debate. MAP1D is also active with zinc, manganese or divalent ions. MAP1D removes the amino-terminal methionine from nascent proteins. It may also play an important role in colon tumorigenesis.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items