Quick Order

Cynomolgus monkey CLEC7A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLEC7AcDNA Clone Product Information
cDNA Size:744
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) C-type lectin domain family 7, member A DNA.
Gene Synonym:CLEC7A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Dectin-1 was recently identified as the most important receptor for beta-glucan. It is a type II transmembrane protein which binds beta-1,3 and beta-1,6 glucans, and is expressed on most cells of the innate immune system and has been implicated in phagocytosis as well as killing of fungi by macrophages, neutrophils and dendritic cells. Recognition of beta-glucan by dectin-1 triggers effective immune response, including phagocytosis and proinflammatory factor production, to eliminate infecting fungi, which especially benefits immunocompromised patients against opportunistic fungal infection. In addition, dectin-1 is involved in the adaptive immune response as well as autoimmune diseases and immune tolerance. Dectin-1 can recognize and respond to live fungal pathogens and is being increasingly appreciated as having a key role in the innate responses to these pathogens. In addition to its exogenous ligands, Dectin-1 can recognize an unidentified endogenous ligand on T cells and may act as a co-stimulatory molecule. Recent studies have highlighted the importance of Dectin-1 in anti-fungal immunity, in both mice and humans, and have suggested a possible involvement of this receptor in the control of mycobacterial infections.

  • Herre J, et al. (2004) The role of Dectin-1 in antifungal immunity. Crit Rev Immunol. 24(3): 193-203.
  • Brown GD. (2006) Dectin-1: a signalling non-TLR pattern-recognition receptor. 6(1): 33-43.
  • Sun L, et al. (2007) The biological role of dectin-1 in immune response. Int Rev Immunol. 26(5-6): 349-64.
  • Schorey JS, et al. (2008) The pattern recognition receptor Dectin-1: from fungi to mycobacteria. Curr Drug Targets. 9(2): 123-9.
  • Reid DM, et al. (2009) Pattern recognition: recent insights from Dectin-1. Curr Opin Immunol. 21(1): 30-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items