Quick Order

Human ACTA2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ACTA2 cDNA Clone Product Information
Gene_bank_ref_id:BC017554
RefSeq ORF Size:1134bp
cDNA Description:Full length Clone DNA of Homo sapiens actin, alpha 2, smooth muscle, aorta with N terminal Myc tag.
Gene Synonym:AAT6, ACTSA, MYMY5, ACTA2
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Actins are globular multi-functional proteins which can be detected in all eukaryotic cells. In vertebrates, there are three main groups of actins that possess slightly different functions: alpha, beta, and gamma. The alpha actins, found in muscle tissues, are a major constituent of the contractile apparatus. Beta-actin, found at the expanding edge of cells, uses the projection of its cellular structure as its mean of mobility. Gamma-actin is found in the filaments of stress fibres. ACTA2 is an alpha actin that is found in skeletal muscle. Expression of alpha skeletal, alpha cardiac, alpha vascular, and gamma enteric actins are restricted to specialized muscle cell type. Smooth muscle alpha actin is of further interest because it is one of a few genes whose expression is relatively restricted to vascular smooth muscle cells. Further more, expression of smooth muscle alpha actin is regulated by hormones, cell proliferation, and altered by pathological conditions including oncogenic transformation and atherosclerosis.

References
  • Ueyama H, et al., 1990, Jinrui Idengaku Zasshi. 35(2): 145-50.
  • Snásel J, et al., 1997, Folia Biol. 42(5): 227-30.
  • Adams LD, et al., 1992, AIDS Res Hum. 8(2): 291-5.
  • Size / Price
    Catalog: HG12160-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"