Quick Order

Human CXCL4 / PF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PF4cDNA Clone Product Information
cDNA Size:306
cDNA Description:ORF Clone of Homo sapiens platelet factor 4 DNA.
Gene Synonym:CXCL4, SCYB4, MGC138298, PF4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CXCL4 / PF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Chemokine & Receptor Related Products
Product nameProduct name

Platelet factor 4 (PF4), also known as chemokine (C-X-C motif) ligand 4 (CXCL4), is a small cytokine belonging to the CXC chemokine family. CXCL4/PF4 is released from the alpha-granules of activated platelets and binds with high affinity to heparin. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, CXCL4/PF4 probably has a role in inflammation and wound repair. This protein is released during platelet aggregation. CXCL4/PF4 neutralizes the anticoagulant effect of heparin because it binds more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. CXCL4 is chemotactic for neutrophils and monocytes. It inhibits endothelial cell proliferation, the short form is a more potent inhibitor than the longer form. CXCL4/PF4 is up-regulated in human liver fibrosis and that it plays a nonredundant, functional role in experimental liver fibrosis by mediating stellate cell proliferation, migration, and intrahepatic immune cell recruitment.

  • Zaldivar MM, et al. (2010) CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 51(4): 1345-53.
  • Lasagni L, et al. (2007) PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion. Blood. 109(10): 4127-34.
  • Struyf S, et al. (2004) Platelets release CXCL4L1, a nonallelic variant of the chemokine platelet factor-4/CXCL4 and potent inhibitor of angiogenesis. Circ Res. 95(9): 855-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items