Quick Order

Cynomolgus monkey IL17RB Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL17RBcDNA Clone Product Information
cDNA Size:1509
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) interleukin 17 receptor B DNA.
Gene Synonym:IL17RB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

IL-17 Family & Receptor Related Products
Product nameProduct name
Canine IL17 / IL17A ProteinRat IL17RA / IL17R Protein (Fc Tag)Marmoset IL17 / IL17A ProteinHuman IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL17 / IL17A ProteinHuman p38 alpha / MAPK14 Protein (Activated in vitro, His Tag)Canine IL-17RD Protein (Fc Tag)Cynomolgus IL17BR / IL17RB / IL-17 Receptor B Protein (ECD, His Tag)Human IL17B / IL-17B Protein (Fc Tag)Rat IL17F / IL-17F Protein (His Tag)Human ERK2 / MAPK1 / MAPK2 Protein (GST Tag)Human p38 alpha / MAPK14 Protein (His Tag)Human IL25 Protein (Fc Tag)Human IL17RD Protein (His Tag)Human p38 delta / MAPK13 Protein (GST Tag)Canine IL17RD Protein (His Tag)Human IL17RA / CD217 Protein (His & Fc Tag)Human IL17RA / CD217 Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17RC Protein (Fc Tag)Human IL17RC Protein (aa 1-454, His Tag)Mouse IL17F / IL-17F Protein (His Tag)Mouse IL17F / IL-17F ProteinHuman IL-17F / Interleukin-17F Protein (His Tag)Human IKB alpha / NFKBIA Protein (His Tag)Human IL17 / IL17A Protein (His Tag)Human IL17 / IL17A ProteinHuman RELA / Transcription factor p65 / NFkB p65 Protein (aa 1-306, GST Tag)Mouse IL17B / IL-17B Protein (Fc Tag)Human IL17RB / IL-17 Receptor B Protein (Flag Tag)Human p38 delta / MAPK13 Protein (Activated in vitro, GST Tag)Mouse IL25 Protein (His Tag)Mouse IL17RA / IL17R / CD217 Protein (Fc Tag)Mouse IL17RA / IL17R / CD217 Protein (His Tag)Mouse ERK2 / MAPK1 / MAPK2 Protein (His & GST Tag)Mouse ERK2 / MAPK1 / MAPK2 ProteinMouse IL17 / IL17A ProteinMouse IL17BR / IL17RB / IL-17 Receptor B Protein (His Tag)Human IL-17F / IL17F ProteinRat IL17RA / IL17R Protein (His Tag)Rat Interleukin 25 / IL25 / IL17E Protein (Fc Tag)Cynomolgus IL17RA / IL17R Protein (Fc Tag)Mouse IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)Human IL17BR / IL17RB / IL-17 Receptor B Protein (Fc Tag)
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Stock P, et al.. (2009) Induction of airway hyperreactivity by IL-25 is dependent on a subset of invariant NKT cells expressing IL-17RB. J Immunol. 182(8): 5116-22.
  • Wang H, et al.. (2010) Allergen challenge of peripheral blood mononuclear cells from patients with seasonal allergic rhinitis increases IL-17RB, which regulates basophil apoptosis and degranulation. Clin Exp Allergy. 40(8): 1194-202.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks