Quick Order

Human ULBP2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ULBP2 cDNA Clone Product Information
Gene_bank_ref_id:BC034689
RefSeq ORF Size:741bp
cDNA Description:Full length Clone DNA of Homo sapiens UL16 binding protein 2 with N terminal Myc tag.
Gene Synonym:N2DL2, RAET1H, ULBP2
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

NKG2D ligand 2, also known as N2DL-2, NKG2DL2, ALCAN-alpha, Retinoic acid early transcript 1H, UL16-binding protein 2, ULBP2 and N2DL2, is cell membrane protein which belongs to the MHC class I family. ULBP2 / N2DL-2 is expressed in various types of cancer cell lines and in the fetus, but not in normal tissues. ULBP2 / N2DL-2 is a ligand for the NKG2D receptor, together with at least ULBP1 and ULBP3. ULBPs activate multiple signaling pathways in primary NK cells, resulting in the production of cytokines and chemokines. Binding of ULBPs ligands to NKG2D induces calcium mobilization and activation of the JAK2, STAT5, ERK and PI3K kinase/Akt signal transduction pathway.

References
  • Cosman D. et al., 2001,Immunity 14:123-133
  • Cerwenka A., et al., 2003, Tissue Antigens 61:335-343
  • Chang,Y.T. et al., 2011, PLoS One. 6 (5):e20029
  • Size / Price
    Catalog: HG12143-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"