Quick Order

Ferret THY1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
THY1cDNA Clone Product Information
Gene_bank_ref_id:XM_004791228.1
cDNA Size:486
cDNA Description:ORF Clone of Mustela putorius furo (sub-species: furo) Thy-1 cell surface antigen DNA.
Gene Synonym:THY1
Species:Ferret
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

Mouse Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

References
  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Size / Price
    Catalog:FG60039-NH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"