After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MVK ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MVK cDNA Clone Product Information
Gene_bank_ref_id:BC016140
RefSeq ORF Size:1191bp
cDNA Description:Full length Clone DNA of Homo sapiens mevalonate kinase with C terminal Myc tag.
Gene Synonym:MK, LRBP, MVLK, POROK3
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Mevalonate kinase belongs to the GHMP kinase family, Mevalonate kinase subfamily. It can be found in a wide variety of organisms from bacteria to mammals. Mevalonate kinase may be a regulatory site in cholesterol biosynthetic pathway. Defects in mevalonate kinase can cause mevalonic aciduria (MEVA). It is an accumulation of mevalonic acid which causes a variety of symptoms such as psychomotor retardation, dysmorphic features, cataracts, hepatosplenomegaly, lymphadenopathy, anemia, hypotonia, myopathy, and ataxia. Defects in mevalonate kinase can also cause hyperimmunoglobulinemia D and periodic fever syndrome (HIDS). HIDS is an autosomal recessive disease characterized by recurrent episodes of unexplained high fever associated with skin rash, diarrhea, adenopathy (swollen, tender lymph nodes), athralgias and/or arthritis.

References
  • Fu Z, et al. (2008) Biochemical and structural basis for feedback inhibition of Mevalonate kinase and isoprenoid metabolism. Biochemistry. 47(12):3715-24.
  • Houten SM, et al. (2000) Biochemical and genetic aspects of Mevalonate kinase and its deficiency. Biochim Biophys Acta. 1529(1-3):19-32.
  • Schafer BL, et al. (1992) Molecular cloning of human Mevalonate kinase and identification of a missense mutation in the genetic disease mevalonic aciduria. J Biol Chem. 267(19): 13229-38.
  • Size / Price
    Catalog: HG13923-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"