Quick Order

Human SLITRK6 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SLITRK6 cDNA Clone Product Information
Gene_bank_ref_id:BC101070
RefSeq ORF Size:2526bp
cDNA Description:Full length Clone DNA of Homo sapiens SLIT and NTRK-like family, member 6 with C terminal Myc tag.
Gene Synonym:MGC119595, MGC119596, MGC119597, SLITRK6
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SLITRK6 belongs to the SLITRK family. Members of this family share two conserved leucine-rich repeat domains in the extracellular domain. SLITRK6 contains 11 LRR (leucine-rich) repeats, 2 LRRCT domains and 2 LRRNT domains. Expression of SlITRK proteins is highly restricted to neural and brain tumor tissues, but varies within the protein family. SLITRK6 is highly expressed in putamen with no expression in cerebral cortex. It also can be detected in adult and fetal lung and fetal liver. It can suppresse neurite outgrowth. In adult brain, SLITRK6 has a critical role in the development of the inner ear neural circuit.

References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wiemann S, et al. (2001) Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs. Genome Res. 11(3):422-35.
  • Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10 (11):1788-95.
  • Size / Price
    Catalog: HG13922-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"