Quick Order

Text Size:AAA

Human ING5 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ING5 cDNA Clone Product Information
Gene_bank_ref_id:BC005370
RefSeq ORF Size:681bp
cDNA Description:Full length Clone DNA of Homo sapiens inhibitor of growth family, member 5 with C terminal Myc tag.
Gene Synonym:p28ING5
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

ING5 belongs to the ING family. It contains 1 PHD-type zinc finger and is a component of the HBO1 complex. HBO1 complex has a histone H4-specific acetyltransferase activity, a reduced activity toward histone H3 and is responsible for the bulk of histone H4 acetylation in vivo. HBO1 complex composed at least of ING4 or ING5, KAT7/HBO1, MEAF6, and one of PHF15, PHF16 and PHF17. ING5 also is a component of the MOZ/MORF complex which is composed at least of ING5, KAT6A, KAT6B, MEAF6 and one of BRPF1, BRD1/BRPF2 and BRPF3. It interacts with EP300 and TP53. MOZ/MORF complex has a histone H3 acetyltransferase activity. Through chromatin acetylation ING5 may regulate DNA replication and may function as a transcriptional coactivator. It interacts with H3K4me3 and to a lesser extent with H3K4me2. ING5 is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. It can bind TP EP300/p300, a component of the histone acetyl transferase complex, suggesting its involvement in TP53-dependent regulatory pathway.

References
  • Zhang F, et al. (2011) The inhibitor of growth protein 5 (ING5) depends on INCA1 as a co-factor for its antiproliferative effects. PLoS One. (7):e21505.
  • Zheng HC, et al. (2011) The nuclear to cytoplasmic shift of ING5 protein during colorectal carcinogenesis with their distinct links to pathologic behaviors of carcinomas. Hum Pathol. 42(3):424-33.
  • Xing YN, et al. (2011) The altered expression of ING5 protein is involved in gastric carcinogenesis and subsequent progression. Hum Pathol. 42(1):25-35.
  • Size / Price
    Catalog: HG13917-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"