After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BLOC1S2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BLOC1S2 cDNA Clone Product Information
Gene_bank_ref_id:BC020494
RefSeq ORF Size:300bp
cDNA Description:Full length Clone DNA of Homo sapiens biogenesis of lysosomal organelles complex-1, subunit 2 with C terminal Myc tag.
Gene Synonym:BLOS2, RP11-316M21.4
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

BLOC1S2, also known as BLOS2, belongs to the BLOC1S2 family. It is a component of BLOC-1 complex. The BLOC-1 complex is composed of BLOC1S1, BLOC1S2, BLOC1S3, DTNBP1, MUTED, PLDN, CNO/cappuccino and SNAPIN. The BLOC-1 complex is required for normal biogenesis of lysosome-related organelles, such as platelet dense granules and melanosomes. BLOC1S2 interacts directly with BLOC1S1, BLOC1S3, MUTED, CNO/cappuccino and SNAPIN. It may play a role in cell proliferation. It also plays a role in intracellular vesicle trafficking. Functionally, BLOC1S2 gene has been proposed to participate in processes (melanosome organization, microtubule nucleation, platelet dense granule organization, positive regulation of cell proliferation, positive regulation of transcription, regulation of apoptosis, positive regulation of transcription from RNA polymerase II promoter).

References
  • Sowa ME, et al. (2009) Defining the human deubiquitinating enzyme interaction landscape. Cell. 138(2):389-403.
  • Gdynia G, et al. (2008) BLOC1S2 interacts with the HIPPI protein and sensitizes NCH89 glioblastoma cells to apoptosis. Apoptosis. 13(3):437-47.
  • Starcevic M, et al. (2004) Identification of snapin and three novel proteins (BLOS1, BLOS2, and BLOS3/reduced pigmentation) as subunits of biogenesis of lysosome-related organelles complex-1 (BLOC-1). J Biol Chem. 279(27):28393-401.
  • Size / Price
    Catalog: HG13916-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"