Quick Order

Text Size:AAA

Human BPIFA2 / C20orf70 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BPIFA2 cDNA Clone Product Information
Gene_bank_ref_id:BC065726
RefSeq ORF Size:750bp
cDNA Description:Full length Clone DNA of Homo sapiens BPI fold containing family A, member 2 with C terminal Myc tag.
Gene Synonym:PSP, SPLUNC2, C20orf70, bA49G10.1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

C20orf70 belongs to the BPI/LBP/Plunc superfamily, Plunc family. PLUNC family is comprised by mucosal secretory proteins that are predicted to be structurally similar to lipid-binding and host-defense proteins including bactericidal/permeability-increasing protein and lipopolysaccharide-binding protein. C20orf70 can be detected in submandibular gland. C20orf70 gene contains 9 distinct gt-ag introns. Transcription produces 6 different mRNAs, 4 alternatively spliced variants and 2 unspliced forms. There are 2 probable alternative promotors, 3 non overlapping alternative last exons and 4 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 3' end. 80 bp of this gene are antisense to spliced gene glopa, raising the possibility of regulated alternate expression. C20orf70 is expected to have molecular function (lipid binding) and to localize in extracellular region. It is a salivary protein of unknown function.

References
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Vargas PA, et al. (2008) Expression of PLUNC family members in benign and malignant salivary gland tumours. Oral Dis. 14(7):613-9.
  • Bingle L, et al. (2009) Characterisation and expression of SPLUNC2, the human orthologue of rodent parotid secretory protein. Histochem Cell Biol. 132(3):339-49.
  • Size / Price
    Catalog: HG13915-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"