After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human HMGN3 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human HMGN3 cDNA Clone Product Information
NCBI RefSeq:BC009529
RefSeq ORF Size:234bp
cDNA Description:Full length Clone DNA of Homo sapiens high mobility group nucleosomal binding domain 3 with C terminal Myc tag.
Gene Synonym:TRIP7, PNAS-24, PNAS-25
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

HMGN3 belongs to the HMGN family and is expressed in kidney, lung, pancreas, testis, skeletal muscle, heart, thyroid gland, pituitary gland, prostate and uterus. Members of the HMGN family bind to nucleosomes without any specificity for the underlying DNA sequence. They affect the global and local structure of chromatin, as well as the levels of histone modifications and thus play a role in epigenetic regulation of gene expression. HMGN3 regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. It also regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. Both insulin and glucagon levels can be affected by HMGN3. HMGN3 may play a role in ocular development and astrocyte function. It also modulates the expression of pancreatic genes involved in insulin secretion.

References
  • Ueda T, et al. (2009) The nucleosome binding protein HMGN3 modulates the transcription profile of pancreatic beta cells and affects insulin secretion. Mol Cell Biol. 29(19):5264-76.
  • Lei SF, et al. (2012) Genome-wide association study identifies HMGN3 locus for spine bone size variation in Chinese. Hum Genet. 131(3):463-9.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: HG13914-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"