Quick Order

Text Size:AAA

Human YWHAB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
YWHABcDNA Clone Product Information
Gene_bank_ref_id:NM_003404.3
cDNA Size:741
cDNA Description:ORF Clone of Homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide DNA.
Gene Synonym:HS1, GW128, KCIP-1, YWHAB
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human YWHAB Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name
Background

14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.

References
  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.
  • Size / Price
    Catalog:HG10843-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"