After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PRSS27 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
PRSS27cDNA Clone Product Information
Gene Bank Ref.ID:NM_031948.3
cDNA Size:873
cDNA Description:ORF Clone of Homo sapiens protease, serine 27 DNA.
Gene Synonym:MPN, CAPH2, PRSS27
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

The name "Pancreasin" because it is transcribed strongly in the pancreas. This secreted, tryptic serine protease, also known as Marapsin or PRSS27 (Protease, serine, 27), which is a member of the peptidase S1 family. Pancreasin is inhibited by benzamidine and leupeptin but resists several classic inhibitors of trypsin. Marapsin was constitutively expressed in nonkeratinizing stratified squamous epithelia of human esophagus, tonsil, cervix, larynx, and cornea. In fact, marapsin was the second most strongly up-regulated protease in psoriatic lesions, where expression was localized to the upper region of the hyperplastic epidermis. Similarly, in the hyperproliferative epithelium of regenerating murine skin wounds, marapsin localized to the suprabasal layers, where keratinocytes undergo squamous differentiation. Marapsin's restricted expression, localization, and cytokine-inducible expression suggest a role in the terminal differentiation of keratinocytes in hyperproliferating squamous epithelia.

Reference
  • Bhagwandin VJ, et al. (2003) Structure and activity of human pancreasin, a novel tryptic serine peptidase expressed primarily by the pancreas. J Biol Chem. 278(5): 3363-71.
  • Li W, et al. (2009) The serine protease marapsin is expressed in stratified squamous epithelia and is up-regulated in the hyperproliferative epidermis of psoriasis and regenerating wounds. J Biol Chem. 284(1): 218-28.
  • Size / Price
    Catalog:HG12116-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availsability:2-3 weeks
    Images
      Please note:All products are "FOR RESEARCH UES ONLY AND ARE NOT INTENDED FOR DIAGNOSTICE OFR THERAPEUTIC USE"