After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Soggy-1 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DKKL1 cDNA Clone Product Information
Gene_bank_ref_id:NM_014419.3
RefSeq ORF Size:729bp
cDNA Description:Full length Clone DNA of Homo sapiens dickkopf-like 1 (soggy) with C terminal His tag.
Gene Synonym:SGY, SGY1, SGY-1, DKKL1
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Dickkopf-like 1 (DKKL1) or soggy 1, is a glycoprotein unique to mammals that is expressed primarily in developing spermatocytes and localized in the acrosome of mature sperm. It is also expressed in the trophectoderm / placental lineage. This glycoprotein is secreted by postmeiotic male germ cells. DKKL1 is a member of the Dickkopf (DKK) family, a group of proteins that are characterized as secreted antagonists of Wnt signal transduction proteins. In mammals, embryos lacking DKKL1 protein developed into viable, fertile adults. DKKL1, either directly or indirectly, facilitates the ability of sperm to penetrate the zona pellucid. DKKL1 is related to the sperm apoptotic procession. Molecular analyses identified the Fas death ligand (FasL) as a target for DkkL1 pro-apoptotic activity in adult mice. DKKL1 is considered as a negative regulator of adult testic homeostasis and identifies a novel, DKKL1 / FasL- dependent, regulation that specifically controls the number of postpubertal spermatocytes. 

References
  • Niehrs C. (2006) Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 25 (57): 7469-81.
  • Kohn MJ, et al. (2010) The Acrosomal Protein Dickkopf-Like 1 (DKKL1) Facilitates Sperm Penetration Of The Zona Pellucida. Fertil Steril. 93 (5): 1533-7.
  • KOHN MJ, et al. (2005) DKKL1 (Soggy), A Dickkopf Family Member, Localizes to the Acrosome During Mammalian Spermatogenesis. Mol Reprod Dev. 71 (4): 516-22.
  • Size / Price
    Catalog: HG10840-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"