Quick Order

Human SFN ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SFN cDNA Clone Product Information
Gene_bank_ref_id:NM_006142.3
RefSeq ORF Size:747bp
cDNA Description:Full length Clone DNA of Homo sapiens stratifin with C terminal His tag.
Gene Synonym:YWHAS, SFN
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a member of the14-3-3 proteins which are a family of conserved regulatory molecules expressed in all eukaryotic cells. The name 14-3-3 refers to the particular elution and migration pattern of these proteins on DEAE-cellulose chromatography and starch-gel electrophoresis. The 14-3-3 proteins eluted in the 14th fraction of bovine brain homogenate and were found on positions 3.3 of subsequent electrophoresis. There are seven genes that encode 14-3-3s in most mammals. 14-3-3 proteins have been identified as adapter proteins implicated in the regulation of a large spectrum of both general and specialized signaling pathway. More than 100 signaling proteins have been reported as 14-3-3 ligands including kinases, phosphatases, and transmembrane receptors, and the binding generally results in the modulation of the activity of the binding partner. YWHAE exists as a homodimer and present mainly in tissues enriched in stratified squamous keratinising epithelium. YWHAS has been repoted to interact with KRT17 and GAB2, and may regulate protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway upon binding to KRT17. Additionally, YWHAS (SFN) may also act as a p53-regulated inhibitor of G2/M progression.

Size / Price
Catalog: HG10838-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"