After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SCN3B ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SCN3B cDNA Clone Product Information
Gene_bank_ref_id:BC117282
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Homo sapiens sodium channel, voltage-gated, type III, beta with C terminal Myc tag.
Gene Synonym:HSA243396, SCNB3, SCN3B
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SCN3B (sodium channel, voltage-gated, type III, beta ,human IgG1-Fc chimera) belongs to the sodium channel auxiliary subunit SCN3B family. It contains 1 Ig-like C2-type (immunoglobulin-like) domain. Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. SCN3B gene encodes one member of the sodium channel beta subunit gene family, and influences the inactivation kinetics of the sodium channel. Two alternatively spliced variants, encoding the same protein, have been identified. Defects in SCN3B are the cause of Brugada syndrome type 7. A tachyarrhythmia characterized by right bundle branch block and ST segment elevation on an electrocardiogram. It can cause the ventricles to beat so fast that the blood is prevented from circulating efficiently in the body. When this situation occurs (called ventricular fibrillation), the individual will faint and may die in a few minutes if the heart is not reset.

References
  • Morgan K, et al. (2000) _3: An additional auxiliary subunit of the voltage-sensitive sodium channel that modulates channel gating with distinct kinetics. Proc Natl Acad Sci. 97(5):2308-13.
  • Hartley JL, et al. (2001) DNA Cloning Using In Vitro Site-Specific Recombination. Genome Res. 10(11): 1788-95.
  • Hirosawa M, et al. (2000) Characterization of cDNA clones selected by the GeneMark analysis from size-fractionated cDNA libraries from human brain. DNA Res. 6(5):329-36.
  • Size / Price
    Catalog: HG13897-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"