Quick Order

Human FABP4 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FABP4cDNA Clone Product Information
cDNA Size:399
cDNA Description:ORF Clone of Homo sapiens fatty acid binding protein 4, adipocyte DNA.
Gene Synonym:aP2, A-FABP, FABP4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Mouse fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.

  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks