After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Lyn Kinase transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LYNcDNA Clone Product Information
cDNA Size:1476
cDNA Description:ORF Clone of Homo sapiens v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2 DNA.
Gene Synonym:JTK8, FLJ26625, LYN
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human Lyn Kinase transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged on other vectors
Related Products
Product nameProduct name

Tyrosine-protein kinase Lyn is a member of the Src family of protein tyrosine kinases, which is mainly expressed in hematopoietic cells, in neural tissues liver, and adipose tissue. Tyrosine-protein kinase Lyn has many functions. Lyn kinase may down regulate expression of stem cell growth factor receptor (KIT). Lyn kinase Acts as an effector of EpoR (erythropoietin receptor) in controlling KIT expression and may play a central role in erythroid differentiation during the switch between proliferation and maturation. Lyn kinase also acts as a positive regulator of cell movement while negatively regulating adhesion to stromal cells by inhibiting the ICAM-1-binding activity of beta-2 integrins. Lyn kinase relays suppressing signals from the chemokine receptor CXCR4 to beta-2 integrin LFA-1 in hematopoietic precursors. This kinase is Involved in induction of stress-activated protein kinase (SAPK), but not ERK or p38 MAPK, in response to genotoxic agents. In a word, Lyn kinase functions primarily as negative regulator, but can also function as activator, depending on the context. Tyrosine-protein kinase Lyn Required for the initiation of the B-cell response, but also for its down-regulation and termination. It also Plays an important role in the regulation of B-cell differentiation, proliferation, survival and apoptosis, and is important for immune self-tolerance. It has been reported that Lyn kinase plays a role in the inflammatory response to bacterial lipopolysaccharide. Lyn kinase Mediates the responses to cytokines and growth factors in hematopoietic progenitors, platelets, erythrocytes, and in mature myeloid cells, such as dendritic cells, neutrophils and eosinophils.

  • Grishin A V, et al. (2001) Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis. Proc Natl Acad Sci U.S.A. 98 (18): 10172-7.
  • Hayashi T, et al. (1999) The AMPA receptor interacts with and signals through the protein tyrosine kinase Lyn. Nature. 397(6714): 72-6.
  • Ptasznik A, et al. (2004) Short interfering RNA (siRNA) targeting the Lyn kinase induces apoptosis in primary, and drug-resistant, BCR-ABL1(+) leukemia cells. Nat Med. 10(11): 1187-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items