Quick Order

Text Size:AAA

Human P4HB / DSI Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
P4HBcDNA Clone Product Information
cDNA Size:1527
cDNA Description:ORF Clone of Homo sapiens procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), beta polypeptide DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Mouse protein disulfide-isomerase, also known as Cellular thyroid hormone-binding protein, Prolyl 4-hydroxylase subunit beta, p55 and P4HB, is a peripheral membrane protein which belongs to the protein disulfide isomerase family. P4HB is highly abundant. In some cell types, it seems to be also secreted or associated with the plasma membrane, where it undergoes constant shedding and replacement from intracellular sources. P4HB localizes near CD4-enriched regions on lymphoid cell surfaces. It is identified by mass spectrometry in melanosome fractions from stage I to stage IV. P4HB reduces and may activate fusogenic properties of HIV-1 gp120 surface protein, thereby enabling HIV-1 entry into the cell. P4HB catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, it seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. P4HB may therefore cause structural modifications of exofacial proteins. Inside the cell, it seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations, P4HB functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, it facilitates aggregation (anti-chaperone activity). P4HB may be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. It also acts a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP.

  • Kivirikko KI, et al., 1989, FASEB J., 3 (5): 1609-17.
  • Pihlajaniemi T, et al.,1991, J Hepatol., 13, Suppl 3: S2
  • Fenouillet E., et al., 2001, J. Infect. Dis. 183:744-752.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Barbouche R., et al., 2003, J. Biol. Chem. 278:3131-3136.