Quick Order

Human CD66c / CEACAM6 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CEACAM6 cDNA Clone Product Information
Gene_bank_ref_id:NM_002483.4
RefSeq ORF Size:1035bp
cDNA Description:Full length Clone DNA of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) with C terminal His tag.
Gene Synonym:NCA, CEAL, CD66c, CEACAM6
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is one of seven human CEACAM family members within the immunoglobulin superfamily. It s a glycosylphosphatidylinositol-linked immunoglobulin superfamily member that is overexpressed in a variety of human cancers, including colon, breast and lung and is associated with tumourigenesis, tumour cell adhesion, invasion and metastasis. CEACAM6 is a unique mediator of migration and invasion of drug resistant oestrogen-deprived breast cancer cells, and this protein could be an important biomarker of metastasis. CEACAM6 is expressed by granulocytes and their progenitors. It is also expressed by epithelia of various organs and is upregulated in pancreatic and colon adenocarcinomas, as well as hyperplastic polyps. Resistance to adhesion-related apoptosis in tumor cells is conferred in the condition of CEACAM6 overexpression.

References
  • Duxbury MS, et al. (2004) Overexpression of CEACAM6 promotes insulin-like growth factor I-induced pancreatic adenocarcinoma cellular invasiveness. Oncogene. 23(34): 5834-42.
  • Lewis-Wambi JS, et al. (2008) Overexpression of CEACAM6 promotes migration and invasion of oestrogen-deprived breast cancer cells. Eur J Cancer. 44(12): 1770-9.
  • Size / Price
    Catalog: HG10823-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"