Quick Order

Cynomolgus monkey IGFBP2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus IGFBP2 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:981bp
cDNA Description:Full length Clone DNA of Macaca mulatta insulin-like growth factor binding protein 2 with C terminal HA tag.
Gene Synonym:IGFBP2
Species:Cynomolgus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

IGFBP-2, also known as IGFBP2, is a insulin-like growth factor-binding protein (IGFBP). IGFBPs prolong the half-life of the IGFs , control bioavailability, activity, and distribution of insulin-like growth factor (IGF) through high-affinity IGFBP/IGF complexes. Six high-affinity IGF-binding proteins (IGFBP-1 to -6) have been identified. The six IGFBPs are structurally related but encoded by distinct genes. IGFBPs have a high affinity for IGFs. Some members of the IGFBP family have been consistently shown to inhibit IGF actions by preventing them from gaining access to the IGF receptors, while others potentiate IGF actions by facilitating the ligand-receptor interaction. IGFBP-2 is overexpressed in many malignancies and is often correlated with an increasingly malignant status of the tumor, pointing to a potential involvement of IGFBP-2 in tumorigenesis. It contains 1 IGFBP N-terminal domain and 1 thyroglobulin type-1 domain. It inhibits IGF-mediated growth and developmental rates.

References
  • Han VK, et al. (1996) The expression of insulin-like growth factor (IGF) and IGF-binding protein (IGFBP) genes in the human placenta and membranes: evidence for IGF-IGFBP interactions at the feto-maternal interface. J Clin Endocrinol Metab. 81(7): 2680-93.
  • Binkert C, et al. (1989) Cloning, sequence analysis and expression of a cDNA encoding a novel insulin-like growth factor binding protein (IGFBP-2) . EMBO J. 8(9):2497-502.
  • Wolf E, et al. (2000) Effects of IGFBP-2 overexpression in vitro and in vivo. Pediatr Nephrol. 14 (7):572-8.
  • Size / Price
    Catalog: CG90083-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"