Quick Order

Human CR2 / CD21 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CR2cDNA Clone Product Information
Gene_bank_ref_id:NM_001877.3
cDNA Size:3102
cDNA Description:ORF Clone of Homo sapiens complement component (3d/Epstein Barr virus) receptor 2 DNA.
Gene Synonym:C3DR, CD21, SLEB9, CR2
Species:Human
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD21, also known as Complement component (3d / Epstein Barr virus) receptor 2 and CR2, is a member of the CD system and is a protein involved in complement system. CD21 is present on all mature B-cells and some T-cells and follicular dendritic cells. CD21 on mature B-cells form a complex called the B cell receptor complex with two other membrane proteins, CD19 and CD81. CD21 has a function in the complement system through serving as the cellular receper specific for ligands such as C3 and C4 which can be attached to foreign macromolecules in order to remove or uptake them. This results in B-cells having enhanced response to the antigen.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Joseph M, et al. (1989) Structure and Function of the Complement Receptors, CR1 (CD35) and CR2 (CD21). Advanced in immunology. 46: 183-219.
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature 358: 505 - 7.
  • Size / Price
    Catalog:HG10811-CH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"