Quick Order

Text Size:AAA

Human RGMA ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RGMA cDNA Clone Product Information
Gene_bank_ref_id:NM_020211
RefSeq ORF Size:1227bp
cDNA Description:Full length Clone DNA of Homo sapiens RGM domain family, member A with N terminal Myc tag.
Gene Synonym:RGM
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

RGMa, also known as RGM domain family, member A, belongs to the RGM (repulsive guidance molecule) family whose members are membrane-associated glycoprotein. RGMa is a glycosylphosphatidylinositol-anchored glycoprotein that functions as an axon guidance protein in the developing and adult central nervous system. It helps guide Retinal Ganglion Cell (RGC) axons to the tectum in the midbrain. RGMa has been implicated to play an important role in the developing brain and in the scar tissue that forms after a brain injury. This protein may also function as a tumor suppressor in some cancers.

References
  • Severyn CJ, et al. (2009). Molecular biology, genetics and biochemistry of the repulsive guidance molecule family. Biochem J. 422 (3): 393-403.
  • Monnier PP, et al. (2002) RGM is a repulsive guidance molecule for retinal axons. Nature. 419: 392-5.
  • Matsunaga E, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nature Cell Biology. 6: 749-55.
  • Size / Price
    Catalog: HG12086-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"