Quick Order

Human BCL6 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human BCL6 cDNA Clone Product Information
NCBI RefSeq:NM_138931
RefSeq ORF Size:2121bp
cDNA Description:Full length Clone DNA of Homo sapiens B-cell CLL/lymphoma 6 with N terminal Myc tag.
Gene Synonym:ZBTB27, LAZ3, BCL5, BCL6A
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The protein encoded by this gene is an evolutionarily conserved 95-kDa protein containing six C-terminal zinc-finger motifs and an N-terminal POZ domain. It has been reported that BCL-6 is present in DNA-binding complexes in nuclear extracts from various B-cell lines. There are many relationships between non-Hodgkin's lymphoma, diffuse large cell lymphoma and BCL6’s translocations. BCL6 can repress transcription from promoters linked to its DNA target sequence and this activity is dependent upon specific DNA-binding and the presence of an intact N-terminal half of the protein.

References
  • Ye BH, et al. (1997) The BCL-6 proto-oncogene controls germinal-centre formation and Th2-type inflammation. Nature Genetics. 16: 161-70.
  • Seyfert VL, et al. (1996) Transcriptional repression by the proto-oncogene BCL-6. Oncogene. 12 (11) : 2331-42.
  • Chang CC, et al. (1996) BCL-6, a POZ/zinc-finger protein, is a sequence-specific transcriptional repressor. PNAS. 93 (14): 6947-52.
  • Size / Price
    Catalog: HG12083-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"