After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SELPLG ORF mammalian expression plasmid (Codon Optimized), C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SELPLG cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:1287bp
cDNA Description:Full length Clone DNA of Homo sapiens selectin P ligand with C terminal Myc tag.
Gene Synonym:CLA, CD162, PSGL1, PSGL-1, SELPLG
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

P-selectin glycoprotein ligand-1 (PSGL-1), also known as SELPLG or CD162, is the high affinitycounter-receptor for P-selectin on expressed on activated endothelial cells and platelets. PSGL-1 is a mucin-type glycoprotein, expressed on leukocytes and platelets as a homodimer of two disulfide-linked subunits of ~120 kD. As cell adhesion molecules, multiple studies have shown that PSGL-1/ P-selectin interaction is required for the normal recruitment of leukocytes during inflammatory reactions, and also participates in hemostatic responses. PSGL-1 protein requires two distinct posttranslational modifications for the Ca2+-dependent recognition by the lectin domain of P-selectin, that is tyrosine sulfation and specific O-linked glycosylation (sialic acid and fucose). PSGL-1 can also bind to other two members of the selectin family, E-selectin (endothelial) and L-selectin (leukocyte), but binds best to P-selectin.

References

1. Sako, D. et al., 1993, Cell. 75: 1179-1186.

2. Wilkins, P. P. et al., 1995, J. Biol. Chem. 270: 22677-22680.

3. Frenette, P. S. et al., 2000, J. Exp. Med. 191: 1413-1422.

4. Vandendries, E.R .et al., 2004, Thromb. Haemost. 92: 459-466..

5. Pouyani, T. et al., 1995, Cell. 83: 333-343.

Size / Price
Catalog: HG13863-CM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"