After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PTX3 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTX3 cDNA Clone Product Information
Gene_bank_ref_id:NM_002852
RefSeq ORF Size:1146bp
cDNA Description:Full length Clone DNA of Homo sapiens pentraxin-related gene, rapidly induced by IL-1 betaV with N terminal Myc tag.
Gene Synonym:TSG-14, TNFAIP5, PTX3
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Pentraxin-related protein PTX3, also known as Tumor necrosis factor alpha-induced protein 5, Tumor necrosis factor-inducible gene 14 protein, TSG-14, PTX3 and TNFAIP5, is a secreted protein which contains one pentaxin domain. PTX3 plays a role in the regulation of innate resistance to pathogens, inflammatory reactions, possibly clearance of self-components and female fertility. Pentraxins are a family of evolutionarily conserved multifunctional pattern-recognition proteins characterized by a cyclic multimeric structure. Based on the primary structure of the subunit, the pentraxins are divided into two groups: short pentraxins and long pentraxins. C-reactive protein (CRP) and serum amyloid P-component (SAP) are the two short pentraxins. The prototype protein of the long pentraxin group is pentraxin 3 (PTX3). CRP and SAP are produced primarily in the liver in response to IL-6, while PTX3 is produced by a variety of tissues and cells and in particular by innate immunity cells in response to proinflammatory signals and Toll-like receptor (TLR) engagement. PTX3 is essential in female fertility by acting as a nodal point for the assembly of the cumulus oophorus hyaluronan-rich extracellular matrix. PTX3 interacts with several ligands, including growth factors, extracellular matrix components and selected pathogens, playing a role in complement activation and facilitating pathogen recognition by phagocytes, acting as a predecessor of antibodies. PTX3 may also contribute to the pathogenesis of atherosclerosis.

References
  • Rolph,M.S. et al., 2002, Arterioscler Thromb Vasc Biol. 22 (5):e10-4.
  • Mantovani A., et al., 2003, Vaccine. 21:S43-S47.
  • Luchetti,M.M. et al., 2004, Clin Exp Rheumatol. 22 (3):S66-72.
  • Mantovani, A. et al., 2006, Vascul Pharmacol. 45 (5):326-30.
  • Inforzato A., et al., 2008, J. Biol. Chem. 283:10147-61.
  • Size / Price
    Catalog: HG12082-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"