After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GLA Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GLAcDNA Clone Product Information
cDNA Size:1290
cDNA Description:ORF Clone of Homo sapiens galactosidase, alpha DNA.
Gene Synonym:GALA
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.

  • Koide al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.