After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CXADR Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXADRcDNA Clone Product Information
cDNA Size:1098
cDNA Description:ORF Clone of Homo sapiens coxsackie virus and adenovirus receptor DNA.
Gene Synonym:CAR, HCAR
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.

  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks