Quick Order

Canine GAPDH Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GAPDHcDNA Clone Product Information
cDNA Size:1002
cDNA Description:ORF Clone of Canis lupus familiaris glyceraldehyde-3-phosphate dehydrogenase DNA.
Gene Synonym:GAPDH
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.