Quick Order

Text Size:AAA

Canine GM2A Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GM2AcDNA Clone Product Information
cDNA Size:591
cDNA Description:ORF Clone of Canis lupus familiaris GM2 ganglioside activator DNA.
Gene Synonym:GM2A
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

GM2A (GM2 ganglioside activator), is a lipid transfer protein which belongs to the ML domain family. GM2A can accommodate several single chain phospholipids and fatty acids. It also exhibits some calcium-independent phospholipase activity. GM2A binds gangliosides and stimulates ganglioside GM2 degradation. It stimulates only the breakdown of ganglioside GM2 and glycolipid GA2 by beta-hexosaminidase A. GM2A acts as a substrate specific co-factor for the lysosomal enzyme β-hexosaminidase A. β-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. It extracts single GM2 molecules from membranes and presents them in soluble form to beta-hexosaminidase A for cleavage of N-acetyl-D-galactosamine and conversion to GM3. Defects in GM2A are the cause of GM2-gangliosidosis type AB (GM2GAB), also known as Tay-Sachs disease AB variant.

  • Wright CS, et al. (2003) Structural analysis of lipid complexes of GM2-activator protein. J Mol Biol. 331(4):951-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items