Quick Order

Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PPP3CAcDNA Clone Product Information
cDNA Size:1566
cDNA Description:ORF Clone of Homo sapiens protein phosphatase 3, catalytic subunit, alpha isozyme, transcript variant 1 DNA.
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged on other vectors
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG13670-ACG$345
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG13670-ACR$345
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG13670-ANG$345
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG13670-ANR$345
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG13670-CF$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG13670-CH$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG13670-CM$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG13670-CY$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG13670-G$195
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG13670-NF$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG13670-NH$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG13670-NM$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG13670-NY$315
Human PPP3CA transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG13670-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

PPP3CA, also known as protein phosphatase 2B, is a member of the PPP phosphatase family, PP-2B subfamily. It is the alpha catalytic subunit of protein phosphatase 2B (PP2B). PP2B is a holoenzyme that is comprised of a catalytic subunit associated with regulatory subunits. It is a calcium regulated enzyme that is activated by calmodulin and participates in the signaling cascades involved in development of the nervous, cardiovascular, and musculoskeletal systems. PPP3CA activates the T cells of the immune system and can be blocked by drugs. It also activates NFATc (a transcription factor) by dephosphorylating it. The activated NFATc is subsequently translocated into the nucleus, where it upregulates the expression of interleukin 2. PPP3CA interacts with CRTC2, MYOZ1, MYOZ2 and MYOZ3. It also interacts with DNM1L. The interaction dephosphorylates DNM1L and regulates its translocation to mitochondria.

  • Frey N, et al. (2002) Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. Journal of Biological Chemistry. 277(16): 13998-4004.
  • Frey N, et al. (2000) Calsarcins, a novel family of sarcomeric calcineurin-binding proteins. Proceedings of the National Academy of Sciences. 97(26):14632-7.
  • Crabtree G R, et al. (1999) Generic signals and specific outcomes: Signaling through Ca2+, calcineurin, and NF-AT. Cell. 96(5):611-4.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items