Quick Order

Cynomolgus monkey CD19 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CD19 cDNA Clone Product Information
Gene_bank_ref_id:XM_005591542.1
RefSeq ORF Size:1674bp
cDNA Description:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) CD19 molecule with C terminal HA tag.
Gene Synonym:CD19
Species:Cynomolgus
Vector:pCMV3-C-HA
Plasmid:pCMV3-cynoCD19-HA
Restriction Site:HindIII + XbaI (6kb + 1.72kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 774 G/A and 843A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus CD19 Gene Plasmid Map
Cynomolgus monkey CD19 ORF mammalian expression plasmid, C-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 19 (CD19) is a member of CD system. CD19 is a cell surface molecule that assembles with the antigen receptor of B-cells. This results in a descent in threshold for antigen receptor-dependent stimulation. A simplified view holds that the ability of B-cells to respond to the various antigens in a specific and sensitive manner is achieved in the presence of low-affinity antigen receptors. CD19 primarily acts as a B-cell coreceptor in conjunction with CD21 and CD81. The formation of the receptor complex is induced by antigen and CD19, induced by exogenous antigen, has been found cytoplasmic tail phosphorylated and bind to sIg.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Carter RH, et al. (1992) CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science. 256 (5053): 105-7.
  • Size / Price
    Catalog: CG90051-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"