After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human GNGT1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GNGT1cDNA Clone Product Information
cDNA Size:225
cDNA Description:ORF Clone of Homo sapiens guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1 DNA.
Gene Synonym:GNG1, GNGT1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-FLAG Vector Information
Vector Name pCMV3-N-FLAG
Vector Size 6098bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-FLAG Physical Map
Schematic of pCMV3-N-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

GNGT1 is a subunit of of transducin. Heterotrimeric G proteins consist of alpha, beta, and gamma subunits. They are membrane bound GTPases that are linked to 7-TM receptors. They function as signal transducers for the 7-transmembrane-helix G protein-coupled receptors. They are involved as a modulator or transducer in various transmembrane signaling systems. G proteins are bound to GDP in the 'off' state. GNGT1 is the gamma subunit of transducin. Ligand-receptor binding results in detachment of the G protein, switching it to an 'on' state and permitting Galpha activation of second messenger signalling cascades. There are several types of Galpha proteins; in addition, some Gbetagamma subunits have active functions. Gbetagamma coupled to H1 receptors can activate PLA2 and Gbetagamma coupled to M1 receptors can activate KIR channels. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.

  • Tao L, et al. (1993) Structure of the bovine transducin gamma subunit gene and analysis of promoter function in transgenic mice. Exp Eye Res. 56 (4): 497-507.
  • Yan K, et al. (1996) Differential ability to form the G protein betagamma complex among members of the beta and gamma subunit families. J Biol Chem. 271 (12): 7141-6.
  • Gaudet R, et al. (1999) A molecular mechanism for the phosphorylation-dependent regulation of heterotrimeric G proteins by phosducin. Mol Cell. 3 (5): 649-60.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items