Quick Order

Text Size:AAA

Human AKT3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human AKT3 cDNA Clone Product Information
Gene_bank_ref_id:NM_005465.3
RefSeq ORF Size:1440bp
cDNA Description:Full length Clone DNA of Homo sapiens v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) with C terminal His tag.
Gene Synonym:PKBG, PRKBG, STK-2, PKB-GAMMA, RAC-gamma, RAC-PK-gamma, DKFZp434N0250, AKT3
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

v-akt murine thymoma viral oncogene homolog 3 (AKT3), also known as PKB-GAMMA, with AKT1/PKBalpha, AKT2/PKBbeta, are the memerbers of Akt kinase family, share extensive structural similarity and perform common as well as unique functions within cells. The Akt signaling cascade initiates at the cell surface when growth factors or other extracellular stimuli activate phosphoinositide 3-kinase (PI3K). AKT3 was discovered to be the predominant isoform activated in sporadic melanomas. Levels of activity increased during melanoma progression with metastatic melanomas having the highest activity. Although mechanisms of AKT3 activation remain to be fully characterized, overexpression of AKT3 and decreased PTEN activity play important roles in this process. Targeted reduction of AKT3 activity decreased survival of melanoma tumor cells leading to inhibition of tumor development, which may be therapeutically effective for shrinking tumors in melanoma patients. AKT2 and AKT3 play an important role in the viability of human malignant glioma cells. Targeting AKT2 and AKT3 may hold promise for the treatment of patients with gliomas.

References
  • Mure H, et al. (2010) Akt2 and Akt3 play a pivotal role in malignant gliomas. Neuro Oncol. 12(3): 221-32.
  • Koseoglu S, et al. (2007) AKT1, AKT2 and AKT3-dependent cell survival is cell line-specific and knockdown of all three isoforms selectively induces apoptosis in 20 human tumor cell lines. Cancer Biol Ther. 6(5): 755-62.
  • Cristiano BE, et al. (2006) A specific role for AKT3 in the genesis of ovarian cancer through modulation of G(2)-M phase transition. Cancer Res. 66(24): 11718-25.
  • Robertson GP. (2005) Functional and therapeutic significance of Akt deregulation in malignant melanoma. Cancer Metastasis Rev. 24(2): 273-85.
  • Altomare DA, et al. (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene. 24: 7455-64.
  • Stahl JM, et al. (2004) Deregulated Akt3 activity promotes development of malignant melanoma. Cancer Res. 64: 7002-10.
  • Size / Price
    Catalog: HG10765-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"