After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rhesus CSF1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus CSF1 cDNA Clone Product Information
NCBI RefSeq:XM_001090841.2
RefSeq ORF Size:1668bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) colony stimulating factor 1 (macrophage) with C terminal HA tag.
Gene Synonym:CSF1
Species:Rhesus
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Human M-CSF / CSF-1 ProteinCynomolgus / Rhesus M-CSF / CSF-1 Protein (Fc Tag)Cynomolgus / Rhesus M-CSF / CSF-1 Protein (His Tag)Human M-CSF / CSF-1 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse M-CSF / CSF-1 ProteinHuman M-CSF / CSF-1 Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human / Cynomolgus M-CSF / CSF-1 Protein (His Tag)Human G-CSFR / CD114 Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Mouse M-CSF / CSF-1 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinRat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman M-CSF / CSF-1 Protein (Fc Tag)
Background

Macrophage colony-stimulating factor 1, also known as CSF-1, M-CSF, Lanimostim and CSF1, is a single-pass membrane protein which is disulfide-linked as a homodimer or heterodimer. Granulocyte / macrophage colony-stimulating factors are cytokines that act in hematopoiesis by controlling the production, differentiation, and function of 2 related white cell populations of the blood, the granulocytes and the monocytes-macrophages. M-CSF/CSF-1 is known to facilitate monocyte survival, monocyte-to-macrophage conversion, and macrophage proliferation. M-CSF/CSF-1 is a secreted cytokine which influences hemopoietic stem cells to differentiate into macrophages or other related cell types. It binds to the Colony stimulating factor 1 receptor. M-CSF/CSF-1 may also be involved in development of the placenta. The active form of M-CSF/CSF-1 is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. M-CSF/CSF-1 induces cells of the monocyte/macrophage lineage. It also plays a role in immunological defenses, bone metabolism, lipoproteins clearance, fertility and pregnancy. Upregulation of M-CSF/CSF-1 in the infarcted myocardium may have an active role in healing not only through its effects on cells of monocyte/macrophage lineage, but also by regulating endothelial cell chemokine expression.

References
  1. Pandit J. et al., 1992, Science. 258: 1358-62.
  2. Tokai M. et al., 2000, J Bacteriol. 182 (10): 2865-8.
  3. Fan X. et al., 2001, Am J Physiol Endocrinol Metab. 280 (1): E103-11.
  4. Frangogiannis NG. et al., 2003, Am J Physiol Heart Circ Physiol. 285 (2): H483-92.
  5. Cupp JS. et al., 2007, Am J Surg Pathol. 31 (6): 970-6.
Size / Price
Catalog: CG90029-CY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"