Quick Order

Human PTGS2 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PTGS2 cDNA Clone Product Information
Gene_bank_ref_id:NM_000963
RefSeq ORF Size:1815bp
cDNA Description:Full length Clone DNA of Homo sapiens prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase) with N terminal Myc tag.
Gene Synonym:COX2
Species:Human
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PTGS2, also known as COX-2, is s component of Prostaglandin-endoperoxide synthase (PTGS). PTGS, also known as cyclooxygenase, is the key enzyme in prostaglandin biosynthesis, and acts both as a dioxygenase and as a peroxidase. There are two isozymes of PTGS: a constitutive PTGS1 and an inducible PTGS2, which differ in their regulation of expression and tissue distribution. PTGS2 is over expressed in many cancers. The overexpression of PTGS2 along with increased angiogenesis and GLUT-1 expression is significantly associated with gallbladder carcinomas. Furthermore the product of COX-2, PGH2 is converted by prostaglandin E2 synthase into PGE2, which in turn can stimulate cancer progression. Consequently inhibiting COX-2 may have benefit in the prevention and treatment of these types of cancer. PTGS2 is regulated by specific stimulatory events, suggesting that it is responsible for the prostanoid biosynthesis involved in inflammation and mitogenesis. It mediates the formation of prostaglandins from arachidonate and may have a role as a major mediator of inflammation and/or a role for prostanoid signaling in activity-dependent plasticity.

References
  • Picot, et al. (1994) The X-ray crystal structure of the membrane protein prostaglandin H2 synthase-1. Nature. 367(6460):243-9.
  • Xie W, et al. (1991) Expression of a Mitogen-Responsive Gene Encoding Prostaglandin Synthase is Regulated by mRNA Splicing. Proceedings of the National Academy of Sciences. 88(7):2692-6.
  • Hla T, et al. (1992) Human Cyclooxygenase-2 cDNA. Proceedings of the National Academy of Sciences. 89(16):7384-8.
  • Size / Price
    Catalog: HG12036-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"