Quick Order

Text Size:AAA

Human PSG6 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PSG6 cDNA Clone Product Information
NCBI RefSeq:BC020652
RefSeq ORF Size:1275bp
cDNA Description:Full length Clone DNA of Homo sapiens pregnancy specific beta-1-glycoprotein 6 with C terminal Myc tag.
Gene Synonym:PSBG-10, PSBG-12, PSBG-6, PSG10, PSG6
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PSG6 is a pregnancy-specific glycoprotein(PSG). PSGs are secreted proteins which are produced by the rodent and primate placenta and play a critical role in pregnancy success. The levels of PSGs are highest during the third trimester of pregnancy, a time marked by the most profound suppression of MS disease attacks. PSGs regulate T-cell function. The regulation of T-cell function during pregnancy is likely the result of significant hormonal changes and may well involve immunoregulatory proteins derived from the placenta. Pregnancy specific glycoproteins (PSGs) are the most abundant placentally derived glycoproteins in the maternal serum. PSG1, PSG6, PSG6N, and PSG11 induce dose-dependent secretion of anti-inflammatory cytokines by human monocytes. Human and murine PSGs exhibit cross-species activity.

References
  • Teglund S, et al. (1995) Characterization of cDNA encoding novel pregnancy-specific glycoprotein variants. Biochem Biophys Res Commun. 211(2):656-64.
  • Grimwood J, et al.. (2004) The DNA sequence and biology of human chromosome 19. Nature. 428(6982):529-35.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Size / Price
    Catalog: HG13808-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"