After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine CXCL16 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine CXCL16 cDNA Clone Product Information
Gene_bank_ref_id:XM_844211.2
RefSeq ORF Size:768bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris chemokine (C-X-C motif) ligand 16 with N terminal His tag.
Gene Synonym:CXCL16
Species:Canine
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Background

C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I membrane protein which belongs to the intercrine alpha (chemokine CxC) family. CXCL16 exists in transmembrane and soluble forms. The transmembrane form acts as a scavenger receptor for oxidised LDL whereas the soluble form acts a chemoattractant for mainly CD8+ T cells. CXCL16 is a protein which shares pattern recognition receptor functions, relevant for adhesion and phagocytosis of bacterial products, with the properties of an adhesion molecule and inflammatory chemokine. CXCL16/SR-PSOX is an interferon-gamma-regulated chemokine and scavenger receptor for oxidized low-density lipoprotein that is expressed in atherosclerotic lesions. Proteolytic cleavage of membrane-bound CXCL16 releases soluble CXCL16, which may promote migration of effector T cells and augment a proatherogenic inflammatory response. CXCL16/SR-PSOX can be a potential player in atherogenesis. Enhanced expression of CXCL16 has been demonstrated in atherosclerotic plaques and several properties have been attributed to CXCL16 that could influence the atherosclerotic process. Following in vitro studies suggested that as an adhesion molecule CXCL16/SR-PSOX might mediate T-cell adhesion to the endothelium, as a chemokine-drive T-cell migration, stimulate cell proliferation and elicit inflammatory phenotype in smooth muscle cells (SMC) and, finally, as a scavenger receptor-mediate uptake of atherogenic lipoproteins by macrophages and SMC. CXCR6 and its ligand CXCL16 in regulating metastasis and invasion of cancer. CXCR6 and CXCL16 are up-regulated in multiple cancer tissue types and cancer cell lines relative to normal tissues and cell lines. In addition, both CXCR6 and CXCL16 levels increase as tumor malignancy increases. Thus, CXCL16 and CXCR6 may mark cancers arising in an inflammatory milieu and mediate pro-tumorigenic effects of inflammation through direct effects on cancer cell growth and by inducing the migration and proliferation of tumor-associated leukocytes.

References
  • Sheikine Y, et al. (2008) CXCL16/SR-PSOX--a friend or a foe in atherosclerosis? Atherosclerosis. 197(2): 487-95.
  • Lehrke M, et al. (2008) CXCL16 is a surrogate marker of inflammatory bowel disease. Scand J Gastroenterol. 43(3): 283-8.
  • Jansson AM, et al. (2009) Soluble CXCL16 predicts long-term mortality in acute coronary syndromes. Circulation. 119(25): 3181-8.
  • Darash-Yahana M, et al. (2009) The chemokine CXCL16 and its receptor, CXCR6, as markers and promoters of inflammation-associated cancers. PLoS One. 4(8): e6695.
  • Deng L, et al. (2010) CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer. Biochim Biophys Acta. 1806(1): 42-9.
  • Size / Price
    Catalog: DG70060-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"