Quick Order

Text Size:AAA

Human DCBLD2 ORF mammalian expression plasmid, N-Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DCBLD2 cDNA Clone Product Information
Gene_bank_ref_id:BC029658
RefSeq ORF Size:2232bp
cDNA Description:Full length Clone DNA of Homo sapiens discoidin, CUB and LCCL domain containing 2 with N terminal Flag tag.
Gene Synonym:ESDN, CLCP1, DCBLD2
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

DCBLD2, also known as ESDN and CLCP1, localizes in various compartments. DCBLD2 is up-regulated in lung cancers and is regulated by transcription factor AP-2 alpha (TFAP2A), a component of activator protein-2 (AP-2) that is known to regulate IL-8 production in human lung fibroblasts and epithelial cells. DCBLD2 could be related to FEV(1)-related phenotypes in asthmatics. DCBLD2 gene is expressed at very high level. DCBLD2 is proposed to participate in processes such as intracellular receptor mediated signaling pathway, negative regulation of cell growth and so on.

References
  • Kobuke K. et al., 2001, J Biol Chem. 276 (36): 34105-14.
  • Adeghi MM. et al., 2007, Am J Transplant. 7 (9): 2098-105.
  • Chen Y. et al., 2007, Proteomics. 7 (14): 2384-97.
  • Park TJ. et al., 2012, J Korean Med Sci. 27 (4): 343-9.
  • Size / Price
    Catalog: HG13615-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"